US 5057410

I'll search for authoritative information on this patent and any associated litigation.

US Patent 5,057,410 — Chimeric Messenger RNA Detection Methods

Sourcing note: No USPTO register record, PTAB proceeding, or Court of Appeals for the Federal Circuit docket entry referencing U.S. Patent No. 5,057,410 was returned in my searches, including searches framed around 2026 CAFC activity. The results I retrieved contain no 2026 litigation involving this number. The summary below is built from the authoritative full patent text supplied in the prompt (Google Patents rendering of US5057410A, fetched 2026‑09‑27) and the bibliographic data contained in it. I have not auto‑corrected any identifier; where the record is internally inconsistent I flag it.

Bibliographic data (per the patent front‑matter/file history in the supplied text)

Literal-reading cautions:

• The Google Patents "Inventor" field spells the third inventor "Owen O. Witto," while the record's own assignment entry spells the same person "WITTE, OWEN O." I do not resolve this; both spellings appear in the source and I will not auto‑correct either.
• The Current Assignee data carries Google's express caveat that listed assignees "may be inaccurate" and that priority/legal-status dates are assumptions, not legal conclusions.

Abstract

"The invention provides highly sensitive methods for detecting specific sequences contained in chimeric mRNA. The mRNA sequences are reverse transcribed into complementary DNA (cDNA), amplified by the Polymerase Chain Reaction, and detected by hybridization with a labeled sequence specific oligonucleotide probe. The method is particularly valuable for the detection of chimeric mRNAs experessed by activated oncogenes that result from aberrant genetic rearragements such as chromosomal translocations."

(The misspellings "experessed" and "rearragements" are as they appear in the source abstract.)

Technical gist

The patent teaches a reverse‑transcription/PCR ("cDNA‑PCR") route to detecting chimeric mRNA — mRNA in which exons from two different genes are spliced into a single transcript via an exon–exon junction. cDNA is made from sample RNA using MuLV or AMV reverse transcriptase (oligo d(T) or a "downstream primer"); the cDNA is then amplified with a primer pair straddling the junction (one primer homologous to the 5′‑side exon, one complementary to the 3′‑side exon) using a thermostable Taq polymerase; and amplification is read out by gel electrophoresis or by hybridization with a junction‑specific labeled probe (e.g., ³²P, HRP, or biotin/streptavidin‑HRP detection). The worked examples target the Philadelphia chromosome t(9;22) BCR‑ABL fusions of CML and ALL, distinguishing BCR exon 3/ABL exon II from BCR exon 2/ABL exon II fusions, and report detection sensitivity down to less than one cell equivalent of cytoplasmic RNA. The specification also hypothesizes a general method (in the "Summary") recited generically as first/second exon, but the granted claims are limited to BCR/ABL and to the named leukemias (ALL, CML) — the generic wording survives only in the Summary and in the copending‑application discussion, not in the claims.

Independent claims — plain-language overview

There are six independent claims: 1, 5, 8, 13, 16, and 19. All are limited to BCR/ABL chimeric mRNA (i.e., the claims are disease/gene‑specific, not generic to any chimeric mRNA).

Claim 1 — Method of detecting ALL‑associated chimeric mRNA.
(a) make cDNA from sample mRNA; (b) mix the cDNA with a first primer homologous to a BCR‑exon sequence and a second primer complementary to an ABL‑exon sequence, forming an amplification mixture for an ALL‑associated chimeric mRNA; (c) run multiplex/standard PCR amplification on that mixture; (d) determine whether amplification occurred.

Claim 5 — Method of detecting CML‑associated chimeric mRNA.
Same four steps as claim 1, but the primer pair is defined by specific sequences: first primer 5'GGAGCTGCAGATGCTGACCAAC3', second primer 5'TCAGACCCTGAGGCTCAAAGTC3'. Detection may be completed with the junction probes of claims 6 or 7 (below).

Claim 8 — Method of distinguishing CML from ALL chimeric mRNA.
A two‑arm assay on the same cDNA: (a) make cDNA; (b) contact cDNA with a first/second primer pair for the CML BCR–ABL junction; (c) PCR‑amplify that mixture; (d) separately contact the cDNA with a third/fourth primer pair for the ALL BCR–ABL junction; (e) PCR‑amplify that mixture; (f) determine whether amplification occurred in each of (c) and (e). Positive signal in one arm and not the other distinguishes the two leukemias.

Claim 13 — Kit for detecting CML‑associated chimeric mRNA.
Comprising (a) the two CML primer sequences (5'GGAGCTGCAGATGCTGACCAAC3' and 5'TCAGACCCTGAGGCTCAAAGTC3') and (b) an oligonucleotide probe. (Dependent claims 14 and 15 name the probe sequences.)

Claim 16 — Kit for detecting ALL‑associated chimeric mRNA.
Comprising (a) a first primer homologous to a BCR‑exon sequence and a second primer complementary to an ABL‑exon sequence, and (b) an oligonucleotide probe specific for the BCR/ABL exon junction. Notably, claim 16 is a kit claim even though the primer pair is defined functionally rather than by sequence; sequence specifics appear only in dependent claim 17.

Claim 19 — Kit for distinguishing CML from ALL.
Comprising (a) a first/second primer pair for the CML BCR–ABL junction; (b) a third/fourth primer pair for the ALL BCR–ABL junction; (c) a first probe specific for the CML chimeric mRNA; and (d) a second probe specific for the ALL chimeric mRNA. Dependent claims 20–24 supply the exact primer/probe sequences, PCR reagents, and a third (distinct) CML probe.

Dependent-claim map

• Claim 1 → 2 (probe‑hybridization readout) → 3 (ALL probe sequence) ; 1 → 4 (ALL primer sequences 5'CGCATGTTCCGGGACAAAAGC3' / 5'GGTCATTTTCACTGGGTCCAGC3')
• 5 → 6 / 7 (CML probe sequences 5'GCTGAAGGGCTTCTTCCTTATTGATG3' and 5'GCTGAAGGGCTTTTGAACTCTGCTTA3')
• 8 → 9 (junction‑specific probes for each arm) → 10 (all four primer sequences) → 11 / 12 (probe sequences)
• 13 → 14 / 15 ; 16 → 17 (sequences) / 18 (PCR reagents)
• 19 → 20 (sequences) / 21 (PCR reagents) / 22 (probe sequences) / 23 (third CML probe) → 24 (sequence)

Sequence-level anomaly worth flagging (not corrected)

The ALL BCR/ABL junction probe appears in two different forms in the granted text:

• Specification / Example 2 (ALL III): 5' GCTGAAGGGCTT↑CTGCGTCTCCAT 3' (with ↑ marking the BCR|ABL junction)
• Claim 3: 5'-GCTGAAGGGTTCTGCGTCTCCAT-3' (one fewer T in the run)
• Claim 17: 5'GCTGAAGGGCTTCTGCGTCTCCAT3' (matches the specification)

Per the operating rule to interpret identifiers literally, I report claim 3 as written: GCTGAAGGGTTCTGCGTCTCCAT. The inconsistency between claim 3 and the specification/claim 17 is in the source and is not something I will silently harmonize. Similarly, the Google Patents claim rendering shows CML probes with the arrows (↑) stripped (...GGCTTTTGAACTCT..., ...GGCTTCTTCCTTATTGATG...), whereas the Examples retain the arrow at the junction.

Items I could not verify

• No CAFC 2026 docket entry for 5,057,410 was found; I have no authoritative confirmation of any Federal Circuit activity in 2026 concerning this patent. Its "Expired – Lifetime" status (anticipated expiration 2008‑10‑15, consistent with a 17‑year term from the 1991 grant date under pre‑URAA law) makes recent infringement litigation involving this patent unlikely, and I found none.
• No USPTO register, reissue, reexamination, or PTAB record specific to this number surfaced in my searches.
• The forward citations listed (58 third‑party/examiner citations, e.g., the Gen‑Probe spliced‑nucleic‑acid patents and the BCR‑ABL variant filings) come from the Google Patents "Cited By" table; I did not independently verify each citation.

If you have a specific CAFC case number or district‑court docket you believe implicates 5,057,410, give me that identifier and I will search it directly rather than inferring.

I'll search for litigation records involving US patent 5057410.

Let me run more targeted searches, including the Unified Patents portal.

Litigation search results for U.S. Patent No. 5,057,410

Bottom line: I found no record of any litigation (or PTAB/ITC proceeding) involving U.S. Patent No. 5,057,410.

I want to be explicit about what I did and did not find, because "no results" is a meaningful but limited answer.

What U.S. 5,057,410 is (for identity confirmation)

• Title: Chimeric messenger RNA detection methods
• Application No. 07/229,604; filed August 5, 1988; granted October 15, 1991
• Inventors: Ernest S. Kawasaki, Francis P. McCormick, Owen O. Witte
• Original assignee: Cetus Corporation → reassigned to Hoffmann‑La Roche (Jan. 1992) → Roche Molecular Systems, Inc. (Jan. 1997)
• 24 claims (RT‑PCR detection of BCR‑ABL chimeric mRNA; CML/ALL primer and probe sequences)
• Legal status: Expired – Lifetime; anticipated expiration October 15, 2008

Sources searched and outcome

Cases that are frequently confused with this patent (they are NOT about '410)

Because the '410 patent is a Cetus/Roche PCR patent, searches surface two nearby matters that do not involve U.S. 5,057,410 — I flag them only to preempt a false positive:

1. E.I. du Pont de Nemours & Co. v. Cetus Corp., No. 89‑2860 (N.D. Cal. 1990–1991); 19 U.S.P.Q.2d (BNA) 1174 — asserted U.S. 4,683,195 and U.S. 4,683,202 (the core Mullis PCR patents), not '410.
2. Board of Trustees of Leland Stanford Junior University v. Roche Molecular Systems, Inc. (N.D. Cal., No. 3:05‑cv‑04158; Fed. Cir. appeal) — HIV‑1 RNA quantitation patents, not '410.

Neither case lists '410 among the asserted patents.

Important caveats

• Coverage limitation. I reached a tool-call limit before I could exhaustively query PACER and the Unified Patents caselist directly, and I could not confirm the absence of litigation from a single authoritative docket index. My conclusion is based on multiple public aggregators, none of which returned a case tied to patent 5,057,410. Treat this as "no litigation found," not as certified proof of none.
• Timing. Because the patent expired October 15, 2008, any past‑damages suit would have had to be filed by roughly October 2014 (35 U.S.C. § 286 six‑year lookback). A suit during the 1991–2008 term remains possible, and would be the most likely place for a record to exist.
• No assignment/ownership disputes located. The only recorded transactions are the routine assignments (Cetus → Hoffmann‑La Roche, 1992; Hoffmann‑La Roche → Roche Molecular Systems, 1997).

Recommendation for definitive confirmation

To close this out with certainty, I'd suggest running the following (which I could not complete):

1. Unified Patents litigation portal — https://portal.unifiedpatents.com/litigation/caselist, filtering on patent 5,057,410.
2. PACER / Docket Alarm / Lex Machina / Westlaw Litigation Analytics — search "5,057,410" restricted to the patent field across all U.S. district courts and the Federal Circuit.
3. USPTO Patent Center "Transaction History"/"Litigation" tab for application 07/229,604, and the USPTO Patent Assignment database.
4. UCLA/UC system tech‑transfer records, since a co‑inventor of the underlying BCR‑ABL work (Owen Witte, UCLA) is a party of interest and the standard file may reference enforcement activity.

If you have a specific suspected case (e.g., a particular CML/ALL diagnostic kit or a named defendant), tell me the target and I'll run a focused check rather than a patent‑number sweep.

Proceedings overview

Total AIA trial proceedings on file for US 5,057,410: 0 — the structured "PTAB proceedings on file" block supplied with this prompt contains no IPR, PGR, or CBM entries, and independent web verification (Google Patents litigation/PTAB tab, USPTO PTAB statistics and decision databases, Justia's patent page for 5057410) surfaced no petition, no institution decision, no Final Written Decision, and no settlement or appeals for this patent under any caption I could identify. Status breakdown is therefore: active 0 / claims invalidated 0 / claims sustained 0 / settled 0 / institution denied 0. The bottom-line defensive posture is not "hardened patent" and not "claims killed" — it is "the patent is gone by its own terms." US 5,057,410 issued 1991-10-15 on a 1988-08-05 application and, per its Google Patents status record, reached "Anticipated expiration" on 2008-10-15 under the pre-URAA seventeen-years-from-grant term. An accused infringer today is facing an expired right, not a PTAB-hardened one.

No proceedings to report

There is no {PROCEEDING_NUMBER} — {Petitioner} v. {Patent Owner} entry to write, because none exists. I will not manufacture a number. Three points of context explain why the empty list is the correct and expected answer:

1. The patent's enforceable life ended before AIA trials were in meaningful use. IPR/PGR/CBM became available 2012-09-16 (AIA § 6(c)). By then US 5,057,410 had roughly four years of nominal term left, had already been assigned to Roche Molecular Systems, Inc. (Cetus → Hoffmann-La Roche, 1992-01-17 → Roche Molecular Systems, 1997-01-27), and covered a diagnostic laboratory method rather than a commercial product claim that a competitor needed to clear.
2. PGR was statutorily unavailable. PGR requires an effective filing date on or after 2013-03-16. US 5,057,410 claims priority to 1988-08-05 and is governed by pre-AIA §§ 102/103.
3. CBM was inapplicable. It covers patents with a financial-services "covered business method" claim; a BCR-ABL/Philadelphia-chromosome RT-PCR diagnostic method is squarely outside the CBM definition — and the CBM program itself sunset 2020-09-16.

The absence is not evidence of validity. It reflects that this patent was never the kind of asset that attracts an IPR: it is old, expired, and owned by the very company that practiced the technology.

Related adversarial history that is not this patent (do not conflate)

Searches did surface substantial Cetus-era validity fighting, but it belongs to different patents and must not be attributed to US 5,057,410:

• Reexaminations 90/001902 and 90/001954 (filed 1989-12-06 and 1990-03-09) challenged US 4,683,195 — the PCR process patent — over Kleppe et al., Khorana et al., Besmer et al., and Panet et al.; the USPTO confirmed the claims on 1990-08-23.
• E.I. du Pont de Nemours v. Cetus, in which a jury upheld the validity of the '195 and '202 patents on 1991-02-28.
• Later, unrelated Roche litigation over the native Taq polymerase patent (inequitable conduct / unenforceability ruling, San Francisco federal district court).

US 5,057,410 is a sibling specification to that PCR family (it cross-references Ser. Nos. 899,513, 063,647, 899,061, 197,000, etc.), but no reexamination, interference, IPR, PGR, CBM, or district-court validity challenge to its own claims 1–24 was located.

Strategic summary

Claim status. None of claims 1–24 was ever canceled, confirmed, or construed by the PTAB. All 24 claims lapsed when the patent expired on 2008-10-15. The claim set is best described as UNTESTED-BY-PTAB and EXPIRED, not "sustained." The claims are the eight method claims (claims 1, 5, and 8 as independents, with 2–4, 6–7, 9–12 dependent) and the four kit claims (13–24, with claims 13, 16, and 19 independent and 23–24 introducing a third probe). If a demand letter cites any of them, the correct first response is not an invalidity argument — it is that the statutory term has run.

Estoppel landscape. There is no § 315(e)(1) or § 315(e)(2) estoppel against anyone, because estoppel attaches only after a Final Written Decision in an instituted IPR/PGR. With no proceeding, no petitioner or privy is estopped from anything. Practically, though, that clean slate buys almost nothing: an IPR is technically not barred merely because a patent has expired (the Board has instituted on expired claims, e.g., Sony Corp. v. Yissum Research Dev. Co., IPR2013-00219, because a FWD still carries collateral-estoppel effect), but the patent owner cannot amend expired claims, and there is no forward-looking exclusionary right left to cancel. Expect the Board and the Director to treat such a petition as low-value, and note that the 2025 discretionary-denial regime (Director-controlled institution, "settled expectations" denials, mandatory-denial proposed rules) makes institution on a 1988-priority, expired patent very unlikely.

Pattern signals. No repeat petitioner (there are no petitioners). No PTAB appeal history exists for this patent. No defensive aggregator — Unified Patents or similar — has ever touched it; no Unified Patents filing appears in any of the database sweeps. The Roche Molecular Systems ownership chain (Cetus → Hoffmann-La Roche → RMS) is intact in the assignment record, so there is no NPE assignment to hang a modern assertion campaign on. The one genuine residual risk is collateral: a plaintiff may cite this patent's disclosure (the BCR/ABL junction primer and probe sequences at SEQ-like tables in Examples 1–2) as prior art against later BCR-ABL assay patents or as evidence of the state of the art, even though the '410 claims themselves are dead.

Recommended next steps

• If you are a defendant and have received a demand citing US 5,057,410: lead with expiration, not invalidity. The patent expired 2008-10-15 (Google Patents status record; "Anticipated expiration 2008-10-15"). Under 35 U.S.C. § 286 the damages lookback is six years from suit — from a 2026 complaint that reaches only activity after 2020-03, i.e., entirely post-expiration. There is no compensable infringement period to sue on, and § 271 activity after expiration is not infringement at all. There is no FWD to link to or quote, because no PTAB proceeding exists.
• Do not expect PTAB milestones. There is no institution-decision deadline, no oral hearing, and no statutory one-year FWD date running against anyone, for the simple reason that no petition is on file.
• Say the absence plainly, and read the signal correctly. Well-asserted, commercially significant patents attract IPRs; this one did not, because it expired four years into the AIA-trial era and its owner was the practicing entity, not an enforcer. The empty docket is a maturity signal here, not a validity signal.
• If you need to confirm the empty result yourself (recommended before filing anything that relies on it), check the USPTO PTAB Decisions page and the PTAB E2E / ODP trial APIs under patent number 5057410, and search the CourtListener docket database for Federal Circuit appeals naming Roche Molecular Systems; as of this analysis neither shows any proceeding or appeal tied to this patent.

Caveat on confidence: I verified absence of PTAB and Federal Circuit activity through the provided structured data plus web searches, and found no record of an IPR/PGR/CBM or appeal. I cannot prove a negative with complete certainty — pre-2013 pre-AIA inter partes reexaminations and old district-court actions are poorly indexed online — but nothing in any source indicates a proceeding against US 5,057,410, and its 2008 expiration makes post-2012 trial activity very improbable.

I'll search for authoritative assignment records before writing anything.

Assignment & Ownership Reconstruction — US 5,057,410

Sourcing note and limitation, stated up front. I could not open a live, authoritative reel/frame record for this patent in this session. The https://assignmentcenter.uspto.gov/ and https://assignment.uspto.gov/patent/index.html records were not retrievable before I exhausted my tool budget, and no search result returned reel/frame numbers or correspondent-of-record names for application 07/229,604. What I do have is the assignment legal-events block reproduced in the authoritative full patent text supplied in the prompt (Google Patents rendering of US5057410A, fetched 2026‑09‑27), which mirrors the three recorded transactions but does not expose reel/frame or correspondent fields. I therefore report the three events with reel/frame = not retrieved and correspondent = not retrieved, and I will not invent either. The chain is short enough that this is a completeness gap, not a substantive one.

Inventors

Cross-reference to the prior section's flag: the Google Patents inventor field spells the third inventor "Owen O. Witto," while the assignment line in the same document spells "WITTE, OWEN O." I do not resolve the discrepancy and repeat it here so the ownership narrative is not read as endorsing either spelling.

Unusual-pattern check — departures within 12 months of filing: No anomaly. All three inventors executed a single "ASSIGNMENT OF ASSIGNORS INTEREST" to Cetus, recorded 1988‑10‑06, roughly two months after the 1988‑08‑05 filing. That is the routine, expected shape for a corporate-inventor patent — the opposite of the "all inventors leave the assignee within a year, portfolio later fire-sold" precursor. What is mildly notable is that a university-affiliated co-inventor's rights were assigned to a company rather than to his university; but since I have no Stanford v. Roche-style written assignment instrument for Witte in this record, I flag it as an observation only, not a finding.

Original assignee

Cetus Corporation, a Delaware corporation, 1400 Fifty‑Third Street, Emeryville, California 94608 — recorded on the assignment as "CETUS CORPORATION, A CORP. OF DE."

• Primary line of business: early-stage biotechnology, and (from the mid‑1980s) the originator and owner of the polymerase chain reaction. A contemporaneous court filing describes Cetus as "engaged in the business of making and selling biotechnology products."
• Did it ship a product embodying the claims? For this patent, effectively yes, in a diagnostic-services sense: Cetus ran a diagnostic R&D program (the Feb‑1986 Cetus–Kodak "Diagnostic Systems Agreement") and the '410 work was done in Cetus's own PCR diagnostics program. I found no evidence of a standalone Cetus BCR‑ABL kit sold under this patent's claims; the commercial embodiment emerged after Roche acquired the portfolio.
• Current status: dissolved as an independent entity. Cetus was financially weakened by (i) the FDA's 1990 refusal of IL‑2 and (ii) E.I. du Pont de Nemours & Co. v. Cetus Corp. (N.D. Cal., asserting U.S. 4,683,195 / 4,683,202). In 1991 it merged with Chiron, and in December 1991 its PCR assets — this patent included — were sold to Hoffmann‑La Roche for a reported $300 million ("Cetus ceased to exist"). Notably, the present patent's own chain shows the Roche assignment recorded 1992‑01‑17, consistent with that December‑1991 transaction. No bankruptcy was involved — this was a merger plus asset divestiture, not a Chapter 7/11.

Assignment timeline

Three transactions are recorded in the patent's legal-events block. All three carry missing fields (reel/frame and correspondent) that I could not retrieve, so those cells read "not retrieved" rather than being guessed.

1. executed 1988 (date not stated) / recorded 1988‑10‑06 — Reel not retrieved / not retrieved

   • Conveyance: Assignment ("ASSIGNMENT OF ASSIGNORS INTEREST")
   • Assignor: MC CORMICK, FRANCIS P.; KAWASAKI, ERNEST S.; WITTE, OWEN O.
   • Assignee: CETUS CORPORATION, A CORP. OF DE.
   • Correspondent: not retrieved. (Recurrence cannot be assessed — see Signal 3.)
   • Context: Initial inventor-to-employer acquisition; routinizes title in Cetus before issue.

2. executed ~Dec 1991 (not stated) / recorded 1992‑01‑17 — Reel not retrieved / not retrieved

   • Conveyance: Assignment ("ASSIGNMENT OF ASSIGNORS INTEREST")
   • Assignor: CETUS CORPORATION
   • Assignee: HOFFMANN-LA ROCHE, INC.
   • Correspondent: not retrieved.
   • Context: Portfolio acquisition (part of the ~$300M December‑1991 sale of Cetus's PCR business), executed while Cetus was being absorbed into Chiron.

3. executed ~Jan 1997 (not stated) / recorded 1997‑01‑27 — Reel not retrieved / not retrieved

   • Conveyance: Assignment ("ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS)")
   • Assignor: HOFFMANN-LA ROCHE INC.
   • Assignee: ROCHE MOLECULAR SYSTEMS, INC.
   • Correspondent: not retrieved.
   • Context: Internal corporate reorganization — transfer into the Roche PCR/diagnostics subsidiary formed in July 1991. The "(SEE DOCUMENT FOR DETAILS)" annotation is standard for intra-group conveyances and is not evidence of any third-party dealing.

Additional context from the record (not confirmed to attach to '410 — flagged as unverified): For a different Cetus patent (US 4,246,347), the same corporate lineage shows two further entity events: a change of name from Cetus Corporation to Cetus Oncology Corporation (effective 1992‑03‑04; recorded 1992‑09‑25; Reel 006268/0881) and a merger into Chiron Corporation (effective 1996‑03‑25; recorded 1996‑10‑31; Reel 008209/0087). Because the present patent was carved out of Cetus and sold to Roche in December 1991, it plausibly skipped the Cetus Oncology / Chiron steps — which would explain why only three events appear rather than five. I did not verify that these reel/frame entries attach to 5,057,410 and do not assert that they do.

No assignment following the 1997 intra-group transfer was located. The chain terminates at Roche Molecular Systems, Inc.

Timeline diagram

timeline
    title Ownership of US 5057410
    1988 : Filed by Kawasaki McCormick Witte
         : Inventors assign to Cetus Corp
    1991 : Patent issued Oct 15
    1992 : PCR assets sold to Hoffmann-La Roche
    1997 : Transferred to Roche Molecular Systems
    2008 : Licensed to CardioDx Inc
         : Patent expired Oct 15

NPE / troll-pattern signals

1. Shell-entity transfer — Not present. No assignee in the chain bears an "IP / Patents / Licensing / Holdings / Ventures" suffix or a registered-agent address. Every assignee is a named operating corporation (Cetus Corporation, Hoffmann‑La Roche Inc., Roche Molecular Systems, Inc.), and the last of these occupied a real Branchburg N.J. / Alameda Cal. operating footprint. There is no single-purpose LLC anywhere in the three recorded events.

2. Known asserter in the chain — Not present. Neither Cetus, Hoffmann‑La Roche, Roche Molecular Systems, nor the downstream licensee CardioDx appears on the public NPE lists named in the task (Acacia, Marathon, IV, IPNav, Wi‑LAN, Conversant/Mosaid, Vringo, Pendrell, Round Rock, Spangenberg entities, etc.). Roche is a serial patent litigant — Hoffmann‑La Roche, Inc. v. Promega Corp. (Fed. Cir. 2003, on U.S. 4,889,818) and Board of Trustees of Leland Stanford Junior University v. Roche Molecular Systems, Inc. — but it litigates as a large operating diagnostics manufacturer against an actual competitor/licensee, not as a licensing-only shell, and neither case names '410.

3. Repeat correspondent across the chain — Unclear / not assessable. The correspondent-of-record fields were not retrievable for any of the three events, so I cannot test recurrence — which is exactly the tell the task asks me to check. This is a genuine data gap, not a negative finding. If the Assignment Center entries can be pulled, this is the single highest-value field to capture: three recordings spanning 1988–1997 for one Cetus→Roche lineage will very likely share corporate counsel (Cetus's and Roche's in-house/outside patent departments), and confirming that would be exculpatory (routine corporate prosecution), whereas a lone repeat attorney appearing on otherwise unrelated NPE filings would be the incriminating version. I found no such attorney.

4. Cascading transfers — Not present. Three assignments over roughly nine years (1988 → 1992 → 1997), each separated by years, not the "multiple chained LLCs in <24 months" pattern. There is no shared-correspondent-address or common-principal clustering to test, and the intermediate hops are a genuine M&A sale and a genuine intra-group reorganization, both independently corroborated (the December‑1991 Cetus/Roche PCR transaction; the July‑1991 formation of Roche Molecular Systems).

5. Pre-litigation transfer — Not present. I found no infringement suit naming this patent (consistent with the prior litigation section of this analysis), so no transfer sits within six months of any such suit. The one dated downstream event — the CardioDx license — runs the other way: it is a license, not a transfer, and it is evidence of monetization by license rather than assertion.

6. Bankruptcy fire-sale — Not present. Cetus never filed Chapter 7 or 11. Its PCR patent estate left the company through a merger with Chiron plus a negotiated $300M asset sale to Roche in December 1991. The transaction was plainly distressed (post‑FDA‑rejection of IL‑2, post‑DuPont challenge), and I note that a distressed negotiated divestiture is the closest analogue to a fire-sale in this record — but it was a solvent, court-supervised-free M&A transaction, not a bankruptcy estate sale, so the signal does not fire.

7. Privateering — Not present. There is no operating-company-to-NPE transfer, and no SEC or press indication that Roche used a shell vehicle to assert against competitors. To the contrary, the 1992 formation of Roche Molecular Systems was expressly a broad licensing program ("about 100 diagnostic laboratories in the United States to license the technology"), and the CardioDx agreement below is a plain-vanilla commercial license of a patent in a portfolio — the inverse of privateering.

8. Defensive aggregator (anti-NPE) — Not present. The chain does not terminate at RPX, AST, LOT, Unified Patents, or OIN. It terminates at an operating diagnostics manufacturer.

Downstream license (relevant context, and an anomaly worth flagging)

The only post‑1997 commercial transaction I located involving '410 is a license, not a recorded assignment, so it would not be expected to appear in Assignment Center:

• Roche Molecular Systems, Inc. – CardioDx, Inc., "Patent License Agreement (Human Diagnostic Services)," effective November 3, 2008; Roche Contract No. RMS‑19004; Field of Use: "human in vitro services." Attachment I ("Licensed Technology") lists, among others, "USP 5,057,410 — Chimeric messenger RNA detection methods" (alongside U.S. 4,946,952, "Process for isolating nucleic acids"). CardioDx was a genuine operating molecular-diagnostics company (Palo Alto/Redwood City, CA; Corus CAD test), not an NPE — it later collapsed under a Medicare non-coverage determination and DOJ whistleblower litigation.

Anomaly I will not silently harmonize: the license is dated 2008‑11‑03, whereas the patent's anticipated expiration is 2008‑10‑15 — i.e., the license appears to date from roughly three weeks after the assumed expiry. Either (i) the license is a portfolio instrument in which '410 was listed for completeness without regard to its own term, or (ii) the Google Patents "anticipated expiration" figure is an assumption (which Google expressly labels it as) and the true expiry was later. I do not resolve this; both remain open on the record I have.

Verdict

Operating-company assertion.

Justification (2–3 sentences): The ownership chain is three unremarkable corporate events — inventors → Cetus (recorded 1988‑10‑06), Cetus → Hoffmann‑La Roche (recorded 1992‑01‑17, mirroring the ~$300M December‑1991 PCR asset sale), and Hoffmann‑La Roche → Roche Molecular Systems (recorded 1997‑01‑27, an intra-group reorganization) — with no shell entity, no licensing-only LLC, no known asserter, and no cascading or pre-litigation transfer anywhere in it; the patent then went out under a straight commercial license to the operating diagnostics company CardioDx (Nov. 3, 2008, Roche Contract RMS‑19004) rather than to an assertion vehicle. Roche is a large operating diagnostics manufacturer that does litigate — Hoffmann‑La Roche v. Promega (’818) and Stanford v. Roche (Stanford's HIV patents) — but neither case involves '410, and no suit naming '410 was located. Caveat on the label: "assertion" here describes the character of the owner (a commercial operating company that enforces patents in its field), not a located suit on this patent; because the patent expired 2008‑10‑15 and no '410 infringement action surfaced, the strongest fully supported reading is simply that this is not an NPE chain — no signal among the eight fired, and two (Signals 3 and 5) are unresolved only for lack of the correspondent/reel data.

Verification link (to close the two gaps — reel/frame and correspondent for all three 1988/1992/1997 events):
https://assignment.uspto.gov/patent/index.html — search patent number 5057410 (same underlying records as https://assignmentcenter.uspto.gov/). Also worth pulling: USPTO Patent Center Transaction History for application 07/229,604, and the Patent Assignment records for the sibling Cetus patents to confirm whether the Reel 006268/0881 (name change to Cetus Oncology) and Reel 008209/0087 (merger into Chiron) entries I found for US 4,246,347 do or do not appear on '410 — that would confirm or refute my inference that '410 was carved out before the Cetus Oncology/Chiron steps.

I'll search for the USPTO record of this patent and its cited prior-art references.

Let me pull the front-page "References Cited" (prior-art citations) for this specific patent.

Let me try to retrieve the front-page "References Cited" list from other patent databases.

Prior-Art Analysis — U.S. Patent No. 5,057,410

Scope note (search limitations). Within my tool budget I located the USPTO-derived front matter and the granted patent's own "Referenced Cited" list, but I was not able to run a direct query against USPTO Patent Public Search / Patent Center, and I could not independently verify the subject matter of one cited foreign document (EP 0181635). Where I am relying on the patent's own words or a mirrored database rather than a primary USPTO screen, I say so. All identifiers are reproduced as found; I have not auto-corrected any.

1. The patent being analyzed (USPTO record)

Literal-reading flag (carried forward, not corrected): the examiner/assignee record spells the third inventor "WITTE, OWEN O.," while the front-matter inventor field (both Justia and Google Patents) spells it "Owen O. Witto." Both spellings exist in the record; I do not harmonize them.

2. Complete set of patent citations appearing on the face of 5,057,410

The "Referenced Cited" (backward‑citation) list on the granted patent contains exactly four patent documents — three U.S. patents and one European (EPX) publication:

Everything else in the "Referenced Cited" block is non‑patent literature (journal articles and two commercial literature items), summarized in §4.

Important distinction: these are the references cited on '410 (its prior art). The 58 documents in the Google Patents "Cited By" table (e.g., the Gen‑Probe spliced‑nucleic‑acid patents, WO 95/25176, US 5,547,838) are forward citations — later documents that cite '410. They are not prior art to '410 and cannot anticipate it.

3. Reference‑by‑reference analysis

3.1 — U.S. Pat. No. 4,681,840 (Stephenson), issued July 21, 1987

• Full citation: U.S. Patent 4,681,840, inventor Stephenson; issued July 21, 1987.
• Filing date: not verified from a primary source in my searches (the issue date is confirmed; I did not retrieve its filing date/Ser. No.).
• Brief description (per the '410 specification's own characterization): "U.S. Pat. No. 4,681,840 issued July 21, 1987, discloses single-stranded DNA probes for detecting BCR sequences and associated chromosome translocations."
• §102 status against the 1988‑08‑05 filing: issued more than one year before the filing date → available under §102(b) (and under §102(a) if before applicant's invention).
• Anticipation assessment: Does not anticipate any of claims 1–24. Critical missing elements:
  • It is a DNA‑probe / genomic‑DNA disclosure; the '410 claims all require chimeric mRNA detection via cDNA synthesis (reverse transcription) — claim 1(a), 5(a), 8(a).
  • It discloses no polymerase chain reaction or primer pair straddling a BCR|ABL exon–exon junction (claims 1(b), 5(b), 8(b), 8(d), 13(a), 16(a), 19(a–b)).
  • It discloses none of the specific primer/probe sequences recited in claims 3, 4, 6, 7, 10, 11, 12, 14, 15, 17, 20, 22, 24.
  • At most it is §103 background art (a BCR‑probe reference combinable with PCR art).

3.2 — U.S. Pat. No. 4,683,195 (Mullis et al.), issued July 28, 1987

• Full citation: U.S. Patent 4,683,195, "Process for amplifying, detecting, and/or cloning nucleic acid sequences," Mullis et al.; issued July 28, 1987.
• Filing date: February 7, 1986 (per the '410 specification's own sentence: "which is a continuation‑in‑part of Ser. No. 828,144, filed Feb. 7, 1986, which issued as U.S. Pat. No. 4,683,195").
• Brief description: discloses the Polymerase Chain Reaction as a method of amplifying, detecting and cloning nucleic acid sequences (this is the source the '410 text cites for the PCR/detection/cloning disclosure).
• §102 status: issued July 28, 1987 — that is eight days short of one full year before the August 5, 1988 filing date, so it is not a §102(b) reference on its issue date. It is available as §102(a) art (patented before the applicant's invention) and, importantly, as §102(e) art — the U.S. application (Ser. No. 828,144) was filed Feb. 7, 1986, whose entire disclosure is treated as prior art as of that filing under pre‑AIA §102(e). (Note the applicants and the '195 patent share the same assignee, Cetus — see §5.)
• Anticipation assessment: Does not anticipate any of claims 1–24. Missing elements: PCR is taught generically, but the reference does not disclose (i) reverse transcription of a chimeric mRNA containing a BCR|ABL exon–exon junction; (ii) a primer pair homologous to a BCR exon / complementary to an ABL exon; or (iii) the specific primer/probe sequences of claims 3, 4, 6, 7, 10–12, 14, 15, 17, 20, 22, 24. Under §102 a reference must disclose every limitation arranged as in the claim; a generic PCR teaching does not.

3.3 — U.S. Pat. No. 4,683,202 (Mullis), issued July 28, 1987

• Full citation: U.S. Patent 4,683,202, "Process for amplifying nucleic acid sequences," Mullis; issued July 28, 1987.
• Filing date: October 25, 1985 (per the '410 specification: "Ser. No. 791,308, filed Oct. 25, 1985, which issued as U.S. Pat. No. 4,683,202").
• Brief description: the foundational PCR patent — "a method for amplifying specific nucleic acid sequences, called the Polymerase Chain Reaction (PCR)."
• §102 status: same as §3.2 — §102(a) and §102(e) art (application filed Oct. 25, 1985, before any plausible invention date), but not §102(b) on its July 28, 1987 issue date.
• Anticipation assessment: Does not anticipate any of claims 1–24, for the same reasons as '195: no chimeric mRNA, no BCR/ABL, no exon‑junction‑spanning primers, no recited sequences. The closest it comes is generic amplification of a known‑endpoint target.

3.4 — EP 0181635 (published May 1986)

• Full citation: European patent application publication 0181635, published May 1986 (listed as "EPX" in the U.S. "References Cited" block).
• Filing/priority date: not verified. I did not retrieve the EP filing or priority date, and my tool budget was exhausted before I could open Espacenet.
• Brief description: I do not know its subject matter with high confidence, and I will not invent one. The citation appears as the sole foreign patent document in the "References Cited" block; in this technology area it is most likely a hybridization/amplification or chromosome‑translocation‑probe publication, but I have no primary confirmation of that.
• §102 status: published May 1986 → a printed publication more than one year before the Aug. 5, 1988 filing, i.e., a potential §102(b) reference (and §102(a) if before invention) assuming the publication date and content are as listed.
• Anticipation assessment: Cannot be assessed without reading the document. Flagged as the one gap in this analysis.

4. Non‑patent literature cited on the face of '410 (prior art of record)

Although the question emphasizes patent citations, the patent's "References Cited" is dominated by journal literature. The most art‑relevant items — because they are the sources of the actual BCR/ABL junction sequences the claims use — are:

§102 caution on dating: several of these carry 1988 dates (Crescenzi, Simpson, Byrne, Sarkar, Murakawa, Harbarth, Farr, Kawasaki, the Blood abstract). A reference must predate the applicant's invention (or the filing date) to be §102(a)/(b) art. Any 1988 item published after August 5, 1988 is not §102 prior art on its face — several of these are likely the inventors' own contemporaneous publications cited for completeness. I did not verify the month of publication for each.

5. Overall §102 conclusion

No cited reference, alone or as the primary reference, anticipates any of claims 1–24.

• The four patent documents cited on '410 are: (i) one BCR genomic‑probe patent ('840) that predates the filing but discloses no RNA/reverse‑transcription/PCR/exon‑junction element; and (ii)–(iii) two generic PCR patents ('195 and '202) that predate the filing only as §102(a)/(e) art and disclose nothing about chimeric mRNA, BCR/ABL, or exon‑junction‑spanning primers; and (iv) one unverified EP publication (EP 0181635).
• Every independent claim requires the BCR/ABL chimeric‑mRNA context — primer pairs with one member in a BCR exon and one in an ABL exon (claims 1, 5, 8, 13, 16, 19) — and the majority of the dependent claims further require the exact nucleotide sequences (claims 3, 4, 6, 7, 10–12, 14, 15, 17, 20, 22, 24). Generic PCR art cannot supply those limitations.
• The realistic invalidity theories against '410 would therefore be §103 obviousness (e.g., '840 BCR probes + '202/'195 PCR + Shtivelman/Hermans junction sequences), not §102 anticipation — and even then the specific junction primer/probe sequences are a strong non‑obviousness anchor. Additionally, because '410, '195 and '202 were all Cetus‑owned, ordinary §103(c)/double‑patenting considerations (rather than §102) would govern any combination of those commonly owned references.

6. What I could not verify / caveats

1. Direct USPTO screen not run. I retrieved the record via the USPTO‑derived front matter as mirrored (Justia, Google Patents); I could not open USPTO Patent Public Search or Patent Center directly before exhausting my tool budget. The bibliographic data above matches the authoritative full text supplied and the mirrored record.
2. EP 0181635 content unverified — I cannot state what it discloses, so I cannot assess it for §102. Verify on Espacenet (publication number EP0181635) before relying on it.
3. Filing dates for US 4,681,840 and the EP publication/priority dates were not independently confirmed.
4. Titles/inventors of the three cited U.S. patents other than '195 and '202 were not independently confirmed; the '840 description is quoted from the '410 specification's own characterization.
5. The Justia "Referenced Cited" rendering lists Todd et al. (1987) Nature 329:599‑604 twice — possibly a rendering duplication rather than two separate citations.
6. Definitional note: "citation for 5057410" is ambiguous. I treated it as references cited on the patent (backward citations, the true prior art). If you instead want the 58 forward citations ("Cited By"), those are not prior art to '410, and I can analyze them separately if you confirm.

I'll ground this §103 analysis in the prior art actually available as of the 1988-08-05 filing date. Let me pull the key references.

Let me pull the remaining prior-art anchors: the copending mRNA/cDNA PCR application, the BCR DNA-probe patent, and the BCR exon structure references.

Obviousness Analysis — U.S. Patent 5,057,410 under 35 U.S.C. § 103

Sourcing note. The "Prior Art" content on this page consists of (i) the references cited in the patent's own "Description of the Related Art" and Example sections, (ii) the Google Patents "Prior art keywords" line (exon, primer, sequence, chimeric mrna, cdna), and (iii) the "Cited By" table — all reproduced in the authoritative full text supplied earlier. I have supplemented those citations with the underlying journal records retrieved above (PubMed/Elsevier) so the date and disclosure of each reference is grounded rather than assumed. No litigation or PTAB record exists for this number (see the earlier sections), so the following is a defensive/hypothetical validity analysis, not a reconstruction of a real challenge. I do not correct any identifier.

1. Legal framework and the operative date

• The application was filed 1988‑08‑05 and never claimed a benefit date earlier than that (the "Priority date" listed is also 1988‑08‑05). The invention is therefore governed by pre‑AIA 35 U.S.C. § 103(a), judged by whether the subject matter as a whole would have been obvious "at the time the invention was made" (i.e., on or about August 5, 1988) to a person having ordinary skill in the art ("POSA").
• The controlling methodology is Graham v. John Deere Co., 383 U.S. 1 (1966) — scope/content of the prior art, differences from the claims, level of ordinary skill, and secondary considerations — as liberalized by KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398 (2007). Under KSR, the motivation to combine need not be explicit; "any need or problem known in the field … addressed by the patent" can supply it, and a combination that "does no more than yield predictable results" is likely obvious.
• Important nuance for this patent: pre‑AIA § 103(c) disqualifies, for obviousness only, prior art that qualifies solely under § 102(e), (f), or (g) when it and the claimed invention were commonly owned at the time of invention. Because Cetus owned both the subject application and several of the key references, this provision matters — see § 8 below.

2. Level of ordinary skill in the art (POSA)

A POSA in August 1988 would have been a molecular biologist/molecular geneticist with a Ph.D. (or M.S. plus several years) and routine familiarity with: cDNA synthesis from mRNA by reverse transcriptase (Maniatis, Molecular Cloning (1982)); nucleic acid hybridization and Southern/dot-blot formats (Southern, J. Mol. Biol. 98:503 (1975)); and the then‑new polymerase chain reaction (U.S. 4,683,202 / 4,683,195). By mid‑1988, PCR applied to cDNA — i.e., "RT‑PCR" — was already in the literature (Powell 1987; Todd 1987), so it is part of the ordinary artisan's toolkit, not an invention still to be made.

3. The prior-art corpus (all pre‑August 5, 1988)

Critical observation: every element the '410 claims recite — reverse transcription of mRNA, PCR with two flanking primers, amplification across a known exon–exon junction, and junction‑specific probe detection — appears in this corpus, and the junction sequences themselves were published in Heisterkamp/Shtivelman/Hermans/Fainstein.

4. Differences between the prior art and the claims

The '410 claims (as mapped in the earlier sections) are disease‑ and gene‑specific: all six independent claims (1, 5, 8, 13, 16, 19) are limited to BCR/ABL chimeric mRNA. The differences over the art reduce to two:

1. Application target: the art applied RT‑PCR generically (Powell, Todd, 899,513) or detected BCR/ABL at the DNA level (U.S. 4,681,840); the claims apply RT‑PCR to the BCR‑ABL mRNA junction. That is a change of target, not of technique.
2. Specific sequences: dependent claims recite exact primer and probe sequences (claims 4, 6, 7, 10–12, 14, 15, 17, 20, 22, 24), and independent claims 5 and 13 recite the CML primers by sequence. But those sequences are read directly off the published BCR and ABL exon sequences.

There is no recited element — no novel reagent chemistry, no unexpected parameter, no new reaction condition — that the art lacks except the identity of the target and the resulting oligomers.

5. Combinations that render the claims obvious

Combination A — the core combination (renders claim 1 obvious)

Mullis '202 + '195 (PCR, with detection) in view of Powell 1987 (or Cetus Ser. No. 899,513) + Shtivelman 1986 + Heisterkamp 1985 (and, for the ALL junction, Hermans 1987 / Fainstein 1987).

• '202/'195 teach the whole of step (c): PCR of a cDNA segment between two primers, and detection of amplification.
• Powell 1987 teaches step (a): synthesizing cDNA from mRNA and amplifying it by PCR. (Ser. No. 899,513 teaches the same for the same assignee.)
• Shtivelman 1986 teaches that the mRNA fuses ABL exon II to one of two adjacent BCR exons, and supplies the junction sequence; Hermans 1987/Fainstein 1987 supply the ALL (more‑5′ BCR exon) junction. This teaches the POSA exactly where to place a 5′‑(BCR‑homologous) primer and a 3′‑(ABL‑complementary) primer — steps (b) and (d).
• Motivation to combine: the same problem the patent itself identifies. Groffen 1984 (cited in the '410 spec) shows c‑ABL breakpoints are dispersed over ≥100 kb, so a genomic PCR across the t(9;22) junction has no fixed target. Heisterkamp/Shtivelman teach that, at the RNA level, the junction is invariant (ABL exon II always joins a BCR exon). A POSA seeking a sensitive diagnostic for a junction that varies in DNA but is constant in mRNA is directly led to reverse‑transcribe and amplify the mRNA. Yoffe 1987 supplies the demand (DNA methods miss disease below ~5% leukemic cells). This is a textbook KSR "problem in the field … addressed by the patent."

Claims 2 (probe readout) and 4 (ALL primer sequences) follow: hybridizing an amplified product with a labeled junction oligonucleotide is the ordinary detection step of '195, and the ALL primer sequences in claim 4 are taken from the Hermans/Fainstein ALL junction.

Combination B — renders claims 5–7 obvious

Combination A + Shtivelman 1986 + Grosveld 1986 (CML BCR exon 2 / BCR exon 3 junctions to ABL exon II).

Claims 5–7 recite the CML primer pair GGAGCTGCAGATGCTGACCAAC / TCAGACCCTGAGGCTCAAAGTC and the CML junction probes (…GGCTTCTTCCTTATTGATG… for the exon‑2 junction; …GGCTTTTGAACTCTGCTTA… for the exon‑3 junction). Shtivelman 1986 expressly discloses that ABL exon II splices to two adjacent BCR exons — precisely the two junctions the probes detect — and the '410 spec itself attributes the primer/probe sequences to Heisterkamp 1985, Grosveld 1986 and Shtivelman 1986. Selecting a ~20–22‑mer spanning a published junction is routine oligomer design under KSR's "finite number of identified, predictable solutions."

Combination C — renders claim 8 (and 9–12) obvious

Combination B (CML primers/probes) + Combination A's ALL arm (Hermans/Fainstein).

Claim 8 is nothing more than running two primer pairs on the same cDNA — one for the CML junction, one for the ALL junction. Doing a known reaction twice, with different primer pairs drawn from the same small published set of BCR exons, is the paradigm of predictable, routine duplication. The motivation is explicit in the specification itself: "at least three distinct BCR‑ABL mRNAs exist … The present invention provides primer pairs designed to selectively amplify each of the three unique junctions … In this manner, the different CML and ALL variants are distinguished." That clinical distinction (Ph⁺ CML 8.5 kb/P210 vs. Ph⁺ ALL 7 kb/P185, per Hermans 1987 and Clark 1988) is the design need that makes the two‑arm assay obvious to try.

Combination D — renders claims 13–24 (the kits) obvious

Combination A/B/C + U.S. 4,681,840 (BCR detection reagents) + conventional kit practice.

A kit claim covering "primers + a probe" (and, in claims 18/21, "reagents for PCR") adds only the packaging of reagents already taught for the methods. A kit is an aggregation of known articles for their known functions; with the methods obvious, the kits are obvious. The specification's own statement — "kits that allow quick and convenient diagnosis" — supplies the commercial motivation; and claim 16, notably, defines its primer pair functionally (a BCR‑homologous primer + an ABL‑complementary primer), so it rises or falls with Combination A.

6. Additional prior-art avenues a challenger would run in parallel

• U.S. 4,681,840 alone as the "gene‑specific detection" reference. It teaches detecting BCR sequences/translocations and would, combined with the PCR and RT‑PCR references, supply both the BCR sequence and the express diagnostic purpose. Its DNA‑only limitation is the very gap the mRNA route fills.
• Gale & Canaani, PNAS 81:5648 (1984) ("An 8‑kilobase abl RNA transcript in CML") and Collins et al., Science 225:72 (1984) — additional pre‑1988 evidence that the CML‑specific transcript (not just the DNA rearrangement) was the discriminating molecule, reinforcing the motivation to assay RNA.
• Ben‑Neriah et al., Science 233:212 (1986) / Konopka (1984–85) (P210) — protein‑based detection, contrasted in the '410 Example 1 as slow/insensitive for clinical samples, strengthening the need for a nucleic‑acid amplification assay.

7. Predictability and expectation of success

In re O'Farrell, 853 F.2d 894 (Fed. Cir. 1988), requires only a reasonable expectation of success, not certainty. Here the expectation is strong: Powell 1987 had already shown that RT‑PCR amplifies a specific mRNA‑derived sequence from the exact tissue type; Shtivelman 1986 had already published the junction; and mRNA is abundant relative to genomic DNA. The '410 specification's own Example 3 reports detection at "less than one cell equivalent" — but that sensitivity flows from PCR itself (admitted in the spec: "The Polymerase Chain Reaction has been shown to be highly sensitive, capable of detecting the equivalent of a single gene from a single cell"), not from the recited primer sequences. That weakens any "unexpected results" argument for want of nexus.

8. Anticipated defenses, and how strong each is

1. Common ownership / pre‑AIA § 103(c). The copending Cetus application Ser. No. 899,513 (and Ser. No. 63,647) would qualify as prior art, if at all, only as § 102(e) art and were commonly owned with the claimed invention — so they are disqualified for § 103 purposes. However, U.S. 4,683,202 and 4,683,195 issued (July 1987) before the critical date and are therefore printed publications under § 102(a)/(b), not "only" § 102(e)/(f)/(g) art, so they remain fully available. More decisively, Powell 1987 — an independent University of London publication — teaches the same RT‑PCR step and is not commonly owned, so the § 103(c) defense does not remove Combination A's teaching.
2. "Specific sequences are not obvious." This is the strongest patentee argument for claims 5–7, 10–12, 14, 15, 17, 20, 22 and 24. But because Shtivelman/Heisterkamp/Hermans/Fainstein published the junction sequences, arriving at a working ~20‑mer is routine optimization. To sustain the claims, the patentee would need evidence that the recited oligomers were non‑obvious choices (e.g., that the conventional junction‑spanning designs did not work). The specification supplies no comparative data selecting the claimed oligomers over other junction‑spanning designs.
3. The claim 3 anomaly (flagged earlier, not corrected). Claim 3 recites 5'-GCTGAAGGGTTCTGCGTCTCCAT-3', which differs from the specification's ALL III probe (GCTGAAGGGCTT↑CTGCGTCTCCAT) and from claim 17's GCTGAAGGGCTTCTGCGTCTCCAT by deletion of one thymidine in the run. This is a double-edged issue: (a) if the claim‑3 sequence is merely a typographical variant of the disclosed junction probe, it is obvious for the same reasons as claim 17; but (b) a probe that does not match the true BCR|ABL junction (as published) may also raise enablement/written‑description (§ 112) problems independent of § 103. I flag it and do not harmonize it.
4. Secondary considerations. No evidence of nexus appears in the record retrieved. Sensitivity and clinical utility are attributable to PCR (Cetus's '202/'195), not to the claimed BCR/ABL oligomers; any commercial success of BCR‑ABL RT‑PCR kits would need to be tied to the specific claimed sequences rather than to the underlying technique.
5. Claim 1 breadth. Because claim 1 defines its primers only functionally ("homologous to a BCR exon" / "complementary to an ABL exon"), it is the most vulnerable claim — it captures any BCR/ABL RT‑PCR primer pair and adds nothing to the art beyond the choice of target.

9. Bottom line

• Claims 1, 2, 8, 9, 16, 19 (functional/two‑arm method and kit claims) would very likely be held obvious over U.S. 4,683,202 + 4,683,195 in view of Powell 1987 (or the commonly owned Ser. No. 899,513, subject to § 103(c)) further in view of Shtivelman 1986 / Heisterkamp 1985 (CML) and Hermans 1987 / Fainstein 1987 (ALL). The motivation is supplied by the art's own teaching that genomic ABL breakpoints are dispersed (>100 kb) while the mRNA BCR–ABL junction is invariant, plus the documented need for greater sensitivity than Southern/northern/protein methods.
• Claims 5–7, 10–12, 13–15, 17, 20, 22, 24 (sequence‑specific claims) are also likely obvious given the published junction sequences and routine oligomer design, but they are the ones a patentee could most plausibly defend on "non‑obvious selection of working sequences." The record contains no comparative data supporting such a defense.
• Claim 3 is anomalous in the source; its § 103 exposure is at least as great as claim 17's, and it also faces independent § 112 risk.

Confidence and caveats: The legal framework and dates are stated with high confidence (pre‑AIA § 103; filing 1988‑08‑05; the references' 1984–1988 publication dates verified above via PubMed/DOI). The strength of any individual combination is a prediction, not a holding — this patent expired 2008‑10‑15 and I found no litigation, IPR, PGR or reexamination in which these combinations were ever tested, so there is no adjudicated record to cite. Mapping of specific prior-art passages to the exact claimed oligomers would require the full texts of Shtivelman 1986, Grosveld 1986, Hermans 1987 and Fainstein 1987, which I could not retrieve before reaching the tool‑call limit; the junction‑sequence disclosures are asserted from their abstracts and from the '410 specification's own attributions, which I have quoted.